BAC Sequencing: Approved Gene List
 
This list of genes was approved for BAC screening and sequencing by the Xenopus tropicalis Genome Project Advisory Committee on April 23, 2003. A set of overgo probes have been designed for the library screening. The JGI will begin sequencing approved BACs in June, 2003. A web interface will be available soon for viewing the sequencing progress of each clone.
 

Gene Probe 1 Probe 2 Probe 3 Probe 4
Noggin gaatgacatcacagccgtatggagcctggctaataaatcc tccaagcaaccaaccctggccatgggccaccacactactt    
GDF-5        
GDF-6 ctgtgggaaattccttgtatccagcaggcatccatccctt ggagtgtacacaagatgcattgacaggcacctgttcaaac    
Wnt14        
En-1 acagttccaagggcagcgactccaacccggctctgctcct tggtgtggcccgcctgggtctactgcactcgctactccga    
Msx-1 ctctgcttatggctacttaccagcccggggtgaaagtaga atccattggaaaccgcttccctgtggggggcatcatgaaa    
Msx-2 ctttacccatcgcgatgtcttctcccaggaagatcaagga acagagacccaagtgaagatctggttccagaacaggagag    
Shh aggactctcatctccagcgatttcctcctgttcatagaga tgatggtggaaccgggcggcaccaaagcggtgagagagct    
Gremlin gtgcatgttactggcatgtagcagtgaatggccactgcag ggatgaactgtctcgtttatgctctaggatcccttttcct    
FGF8 cgtctccctggctgtggctcggtgccctctcttccagact aaggggatgggcggagggaactgcgggagctcccgggact    
beta-Globin cggtgcaatccaacatctggatgatgtgaagagccacctt actgggtaaaacaaatgtctacagagaatgttgtaaacca    
alpha-Globin (adult) gggcagtataataagcccagaaaccattactatgttattt gagcttatgtaaatacccccaaaatgactctatgtcctgt    
alpha-Globin (larval)        
Sox3 aggagaaccccaagatgcacaactcggagatcagtaagag aatgctgctgcctctacctatagcatgtcccctgcctaca    
Sox2 gcccttcccaatactattagctctagtctcacagtgatga tggactatttttgtacagaagaaaacaaaaatctggggag    
Nrp1 gtggaaagattgctccttctcctctcgtctctactggacc atacccactacccctgaggtgaacggaatggacgaatgtg aatgtgcgttggaggaacgtgaagccaagcttttctcagg  
Nrp2 cagggtacccaaatgattacccacctcatcagaactgtga ggataatcagtgctccagaacccaaccagaagattgtact    
Xotx2 tcaggcataaaggagctcgcttaggcacctcatcggttaa atggggggcaaaacaaagtgagaccctctaagaagaagcc tctccacatcatcctcatgcatgcagaggtcttaccccat  
HoxB9 agttcttcctgctcacatttgctgctggggaacttgtctt atgaccggccctggccaatcccaggacccagccactcata    
xMeis3 acttccagtcttgtccaggaacagctgcccttcttccaca acccctctgaagaacagaaaaagcagctagcacaggatac    
XKrox-20 aatgagaagcgatcgctggatttctcctactcgtccaact      
EphA4 aactgacccatgatgctagcctcactcagaaagtctctcc cccacattacaatgccatagctccagacatcactggcaga    
En-2 gaaggaataagccatcaggatgagctcttttctggcagag tttgactgagcagaggaggcaaagtttggctcaggaactc    
XNot tgttacacagccctgtctttcctgcatttgggcaccactt taccctactcccattgcccaaatggttccatgaaccctct    
Xbra gatgaggttcaaggagctcaccaatgagatgatcgtcacc gaatccacatagtgagagttggaggcacccagagaatgat    
Derriere tctctgctcactgtgtctctagacccatccagctgcaaaa gactctggtgcattctgtagaaccagaaagcacccctttg    
Xnr1 (Nodals) agctgtaccagaaccttgtcatggcaaacgatacagggct attgtgcgtcccgataaagatgagccctctctcaatgttg    
Xnr2 (Nodals) gttaagaacctgcacgagagagtcaggccacgtgtcatta ggaatatcccatcctgcaggaatctgatgccgttctaagc    
Xnr3 (Nodals) agagaagagaatgcccttcctgtgtccccgtgaagatgag tcaggagtcaccaagaatctacccagagatggcctttctc    
Xnr4 (Nodals) cagctacctgaaacacatgtccagcaagcctcaggatcat gcagagtttgctgaactactacgctaaaggaaaggccccg    
Xnr5 (Nodals) gtgccagtgaagatgagacttctgtcaatgctcatgtacg tgcccactcttcttcacacaaaggaggccaggttcccttt    
Xnr6 (Nodals) catctatcccaagaggttcaacgcatttcgttgtgagggg gcatatatgggagcaggcattctcagggcatgaagtatcc    
Slug alpha        
Slug beta cactgcaacagagcatttgcagacagatccaacttgcgag aggaggaaagactccagaccaaactttgcgactcacatgc    
Xtwi (Twist) gtccgcaatcctttgaagaactgcaaagccagagggtcat ttgattcttggttcagaaaactgtttctatacaagcggcg    
Pax3 tgatggatccggtctcctggtagcggcaaaggatcttgga aaacactccacccagctggttcaccctgccttggcctaaa    
Pax6 gtcacagcggagtcaatcaactcgggggagtgtttgtgaa cagacatcctcctactcatgcatgctgcccacaagtccat    
Pax7 ttaggccaaggcagggtgaaccagctgggtggagtgttta cggacgtagagaagaagatcgaggagtacaagcgggagaa    
Nkx6.1 ctcccattgcccaaatggttccatgaaccctctttcatgg atttatagtcactgtgttacttccacagtcctgatgcctt    
Dbx1 tctatccagactgccctgtccagccacaccagctttctca cctccccttttaactccagcattgccagtaaaccctcaga    
Dbx2        
Xiro3 (Irx3) gagttcgtatggtttgtcttgtgctaattaaacgtcggtc tacgctgggcttgaaatgtcaatcacagtgtgagtgccaa    
Olig2 ttcctttaacctccaagttagtggaagcaatcggaacacc gataaaaggggagagtgagagataattaacaaaaaacatg    
Nkx2.2 gatctgcctgataccaatgacgacgaaggatccattgcag tgtcagtcacctgcatatagatctatacagctgtatatgt    
Beta-tubulin tcagtgtgatgccatcacccaaagtctcagacactgtggt tgatcctacacgcagttaccatggagacagtgatttgcac    
Pax8 ggagattacaaacgccagaaccctacaatgtttgcctggg aggctctccctattactacagctctgccacaaggactgca    
XHex acccatttcacgtggaccatatggacagcccttttatggg acccaactcccttctacattgatgatatcctgggaaggag    
Nkx2.5 tctgaactcactgaggaacttgcccagagagactcctcta ccattctctgtaaaggacattttgaacttggagcaacacc    
MyoD tctcttgtgggcatgcaaagcctgtaagaggaagaccaccaa tgacttctacgacgacccctgtttcaatacctcggacatg    
XMyf-5 agcatgtaagagcacccattggtcaccaccaagcaggtaa acttggctacattttgtatttaacgttaataaccaagcct    
HoxA gctttcacactcgacactcattcctcctccttttgagcag gcactttcttttatttttctattgcattaatatgcgctgt cttacaccaaggtgcagctaaaggagctggagagggaata ccggtgatgtttctttacgacaacagcctggaggagatga
HoxB tggtcgaactggagaaggagtttcacttcaaccgctacct gaaatggccaatctgctcaacctgagcgagaggcaaatca gagctggagaaagagttccatttcaatcggtaccttaccc acatgacaggtccggatgggaagcggggcaggactggcta
HoxC accaaccaagggatgtatatgcagactgggagcgatttca gaaaacgctgcaggaaattggctgacagctaagagcggaa ggcagatcaaaatttggttccagtaccgacggatgaaatg gttcccggacaagttacattcgataccagaccctggattt
HoxD cgccgacgaattgaaatagctcacactttgtgtctgtctg atggttccagaacaggagggtcaaggacaagaagatcgtc aagaagagggtgccctacaccaagctgcagctcaaagaac  
Tcf-1 ggacacatacaatggccagcagagttcagcaccacctctt aggactcaatcagtcccacctttcacagcacctcaac    
Lef-1 aaggggatccccaaaaggagaagatctacgctgagatcag tagctcgcaaagaaaggcaactacacatgcagctttaccc    
Tcf-3 ctccagagcaaaaagcagaacgtgaaaaggagagacgggt ttaaagagctggggaggatgtgtcaactgcacctcaacag    
Tcf-4 aaggcagagagagagaaggaaaggcggatggcaaacaatg atggtgcaacttcacctgaagagcgataagccccaaacca    
Tshb acgtgaatccgctcttttcctacccagtagccattagctg atgcaacactggctacactgactgcgtccaagataccatc    
Bambi aggcagacaccaacatgacaacacaaggaacctcatcacg gtctgcacgatgttctgtctcatcccaggagtgatacatc    
Bmpr2        
Tsg actgcattttaccccctttcctgccactgaggcaagctat tctttggtggccaagtatgaagccctctctcctacccatt    
Rb1 cgacttttgagagaaatggatatcaacatggatgttctca gtacttagagcgctgtgagcatcaaattatggagagcctg agacattcaaacacgtactgatccgagatgggcagcatga  
Pitx1 cctggcaattgtatgtatgctatgcctatagatcaatcga tggccactagtttccatttgcagcgatcatctgaagccag    
Pitx2 tgggagcctactgtattatacccccaccatcctccatgaa gctctgctataagtgaatgagagcagcatcccttgtgcaa    
Pitx3 gactatgccctcatcaatggtaccttcagcagtgactgga ttaccagccagcaacttcaggagctggaggcaacttttc    
Lens-1 tggtgcagagcttactcaccattccttaggcttgaatggg cccagatgacttttgctgtgttgggactgagagggttttg    
FOXG1B/BF-1 tcccttaacccttgctctgtcaaccttctcgctggacaaa agatgcacagaggggacgcttgttgtgtttattttgaagg    
EIF4A2(-like) atgctctggaaggaaggctgttgggctttttcttctctcc ccatcagccatacaacaaagggcaatcattccctgtatca    
Zic1 ggctgaggaggtgaaagtttctccccaggaagataaaccg gccctatctgtgtaagatgtgcgacaaatcgtacacccac    
Zic2 aacagcttcgtggaacctactcacatgggcgcatttaagc ggtccttcatctggggggaatctgaactaagttccccgca    
Zic3 ccacacagttcaggatgcatttacggccttggaaatgaca gggaatttcattgaatctttaatgaacagatatcatgctg cccagctgagtttctattggtgcaattcagactgcctcct tcctgtgaaagtggctcaatagacagacttttgggctcag
Dlx3        
Eya1 atctagccagtccacatagtagacttagtggcagtggtga atgccattttggagaatcacaagccactctgacctgatgg    
Vax1 ccgggcacaatatcttcaacatgcctgtgccatccctact tgtaccggctggagatggagttccagaggtgccagtacgt    
Vax2 ctcatcttctccaaggttaccgaccccactttgttttccc gctaatagtatgggcgatggagtgtccgaggagagaagcc    
Gli1 ccacagaatactgccaccaaatggccatcttggccagtca ataggcaacatggccataggagacatgagctccatgctca    
Gli2        
Gli3        
Xanf1 tggtggtttcccataatagaggagttagtcggcggtactt ttgagtctctccagcggaaccatgtctcctggtcttcaga    
Six3 ggacctctaccatatcctggagaatcacaagttcaccaag tctgggacggagagcagaaaacgcactgcttcaaggagag    
Emx1        
Emx2        
XBF2        
Rx agaggatagtgtcctgggctcatttcagactgagctcagt tttggtagcccctatgtggactggcagcctataggagact    
ET        
Lim2        
Tailless        
Xwnt-8b ctctcacttgggatcttttaccaggccagactcaacactt tgccttaaaaggggtaaagctctcagcaagtgggagaaga    
Pax2        
Wnt1        
Xiro1        
MafB tcagcaaagaggaggtaatacgcctgaagcagaagagacg ttttggggttgggaggaagggagggggtgaaaccattgct    
Gbx2 ttctgcgggaagaatcccaaacacagaaggagaaagtccc ccagagcctcagattatgttgtggttaatttattctgtgt    
Pintallavis atacctcagcagtggactccagaacatgctaaatagagtc accacagaccatcttgtccattactctaactacagctctg    
Cad1        
Cad2        
Cad3        
FoxD3a & 3b caaacgaacccctgattcctgcaggatggtctcttcctat ccattggcccaatcttaagtgtccccacaaacctcatctc    
Mitf cacggattttgctacgacagcaactgatgcgtgagcagat gcttggagtccagttataacgaagacattctcttgatgga    
Evi-1        
XL-maf        
XProx1        
nephrin        
Lim1        
FoxD5        
Six1 catgtctatgctgccttcctttggcttcactcaggagcaa cagaatcagctgtcacccctagatggaggaaagtcgctaa    
xWT1 ccgtaccagtgtgatttcaaagactgcgagaggcgatttt aacctgccaacgaaagttctccaggtccgaccacctgaag    
Crygc        
FoxA1/HNF3a cctaggaccagtaacattctcctggaaaatgtggtgggct ttctctccctgccactcgaactactcgctggctgaatgtt    
FoxA2/HNF3b ccaggcactcagcttccagtatgctcggggctgtgaaaat tactcgtacatctcgctcatcaccatggcgatccagcagt    
Gata6 tgagtcccgcgaattccttcttcccctgtccgatcaaaca tgtggatggaatggaggcaattcgggcgcagagtttcatt    
Sox17alpha ctagcgacgatcagaatcagggaaagtgctcagtgccaat caatgtgaaacggtctgattattgtgtacgtggtacactg    
HNF1b atggcacaacagccatttatggccactgtcactcagcttc ctcctgaagtcttctgctgcttgttgctgctcacaggaat    
endodermin agatataacgtcccccaccccaaagaagatgccgctttca acagcgaagttttgcgaaggaacgaagaagcaccagctgt    
FOR1 cgtggaaagcaagagacacaaagcttacccccttgctgta atgagacagtgggaagacctggatcagaccatggcaaaca    
Endocut gttctgttatcccctgtgccaaaggatggggtttttcagt gagggaatggaagaagtgggatctgatggactggagaaac    
Vito atcactgcacctgtagttacctcccctgggcatactttct acttcgctttaataagtttgtccggctcctcggcaccata    
Pdx1 ttcttctgctctgccaacttcgccccagtccaatcccatt ttattcatcgcatagtacagtgtgctagcatagaggcgta    
FLRT3 ccgcacttggtttgttttgcacaggaagcagggcaaatac atgtgttccctctgctcactgatcctgcatggtactagct    
Snail acaagtacccacttcctgtgatcccccagccagagatttta tgcgactgcgaacccaggaatcccctcatcggctgctaaa    
DHCR7 ggaagtggattacttctcattggctgccgtcctgttccta aacgcctaccacttccactggttctccccgaccatca    
Sizzled tcgcacaactgcaaacatgactggagtcttcctgctcctc ccgcagcatgtgtgttgctgtaagagacagttgtgcccca    
WNT11 ggatggtttagtccctgaacagtctcagctctgcaaaagg gtcaccaggggtataaatgccagaggcagcaagaacaaag    
Mix.2 tggactcattcagccaacaactggaggacttctacccttc gccatagacatatggcacttggactctggggtgggaatgt    
c-fos agcagcaccgaatatgatgcagcttcttcccgttgcagta tggtttgacagcttggtgagccaggactgacggtctttct    
XL045a20 ccagaacatttcctgcaactgtccttgtggctggaactga gctattgatgtgctggggaaggacgagctcgatcagacct    
Rnd1 gttggatttgtcccaccatactccctgcatcaccatgaag gtatattccgagcagcgtcttccgcgtgtgtgaacaaagc    
Jun-B cacacactttgtccctggcttagggggacttgtgggtatt acggaggagcaagaatgctttgtggatgggttcgttaagg    
TA2-like        
xIRG agctctgatattgccctcattgcccagacatgttctcagc gtttcaccctccctcagttgtcggaaccatgggaagtgca    
siamois ggtttggttccagaacagaagagccagacacctcccaaga cagacatgacctgtgagcctgaaatggagcagattgtctc    
chordin ttgctgccatgaagcagtgggattctagaggcagcatttg ataatgagcgctggcatccaactgtgacaccctttggaga    
XSPR-2 tgatgaactgcagaggcaccttaggactcatactggtgag tggtgtccctaaagtgcagtatcctggccacatgcaaact    
MAP kinase phosphatase X17C cctgttctctcctcaatgctagagaagttgagacccgctg atagttcctgtggcagtagctctccaccggtccttggttt    
frizzled-10B gggcagctctatgttatccaggaaggcttggaaagtacag taaggagggtgatgaaaactggtggggagaacacagacaa    
Xlim-5 ctgaataaggatgcgcgaattgccaagcttggcactcaga ggtgccatctagtgatctgtttcaacactgcaactcttcc    
FGF-3 ccccgaatgtgagtttgtggaaagaattcacgagctcgga gtgctagacaacaaggaccatgacgccgtgaggttatttc    
eFGF ggtatttttagagcaattgactccttaaaccacgtgtgcc ggtaaagtgctatggctgagctgttggggaagatcaacac    
Eomesodermin        
Edge-2 gctgggacttgtctcaggggaaaggctgtgtctctcccaa agatgtcaaaccagcgggtgtgcatcctcattgcctgcat    
Mixer tccgccaaagcaagaaatggtctcccccgtatcttcagct ttctctccagtctcagattctgggcgtagtgatggctcta    
Xopl atcaaccccttcgcagacggcatgggagctttcaagctca gccctatctgtgtaagatgtgcgacaaatcgtacacccac    
Xag1 tgcacattgtgctccttctgatgctggagagatgaccaca tggtaactctgccaagtctgatccagagcccgtaccaata    
Xcg        
Gob4        
MetTK        
HNF1a/LFB1 taacagcgttggtagcagcttgaccacactgcagtctgtt tctccttcacacagcaccattgacagtttcatgtccaccc    
Evx2 aggggaaagaagctcagccagtatcccgaagtttccaaag cctgctgcaaatcatcatcatctctatctacagcagcagc    
Insertion mutant        
CaV2.2        
VegT gcctatagctacagtgctgcaatgagaaactgctgtcagg gtctccatctggttgtacaccttcaataaatgtcctcctt    
Geminin L & H aaggctaaagttgaggtggctgttgatctagagcacagag ggaaatgcaccacgaagccttgaagacttaaagaatctgg    
XL17        
XL18 agggtggaagagtgttatgcaaccccaaccaatgacccaa ccccatgctccttaattttacctgcagttacaacctgaca    
Eya2        
Eya3 ttcagacaccatctccacctgctgtgctaacctcatcagg ctcagccatacacagtttaccctcaggcttcgccaacgta    
XCtk1        
Xmc        
Fibromodulin        
PAPC        
Fullback        
ADMP        
Retrotransposon 1a11        
Prickle        
MHC-Larynx        
Wnt5a        
Glypican4/6        
Formin